![]() |
![]() |
![]() ![]() |
PAZAR Documentation
Data formats » PAZAR GFF format
PAZAR GFF FormatOverviewThe PAZAR GFF format (What is GFF?) is intended to capture simple annotations. It is not meant to record a detailed annotation. Please use the XML format if you want more options. One record is on a unique line and holds one annotation for one sequence, this annotation coming either from an interaction or an expression experiment (not both in the same record). The record is stored as an interaction if db_tfinfo is provided. If you want to record an interaction but the factor is unknown, state: db_tfinfo="unknown" If db_tfinfo is not provided, the record will be stored as an expression. An interaction will be stored as "good" and an expression as "induced". If you want to record a specific expression level, use the expression field. If a mutant sequence is reported it is assumed that this mutant has an impaired activity compared to the annotation of the original sequence (interaction = "none" or expression = "no change"). Structure of formatFields are: <seqname> <source> <feature> <start> <end> <score> <strand> <frame> [attributes] Those 9 fields are tab-delimited. The attribute field must have a tag value structure with the following syntax, flattened onto one line by semicolon separators: tag1="value1";tag2="value2"
Mandatory fields
Mandatory attributes
ExamplesInteraction examplechr7 oreganno_example OREG0000056 99037559 99037584 . - . sequence="gcatcaagaacatgtggttctaatgg"; db_seqinfo="EnsEMBL:NCBI 35"; species="Homo sapiens"; db_geneinfo="EntrezGene:1576:CYP3A4"; band="q22.1"; analysis_name="gff_example1"; db_tfinfo="EnsEMBL Transcript:ENST00000289790:USF1"; method="EMSA_analysis"; evidence="curated"; pmid="14742674"; impaired_mutant="gcatcaagaacatTAggttctaatgg"
Expression examplechr7 oreganno_example OREG0000056 99037559 99037584 . - . sequence="gcatcaagaacatgtggttctaatgg"; db_seqinfo="EnsEMBL:NCBI 35"; species="Homo sapiens"; db_geneinfo="EntrezGene:1576:CYP3A4"; band="q22.1"; analysis_name="gff_example2"; cell_type="HepG2:Homo sapiens"; method="gene reporter assay"; evidence="curated"; pmid="14742674"; impaired_mutant="gcatcaagaacatTAggttctaatgg"
|