The menos 600 x project in PAZAR Help


CTTctgttagcacagctgtttctagggtctggaaaaactctaaggacccccaggaggatacacaccagattgggtctggg ctcacaccaccctgcatccccagagcctccctggacgctgtttgcaaggtcctcaccgcctggaagtccaggagccattt ttagggaacagcattcaagctcaacatggcaagttccctctttcctgcaggggaggaccagaagggagccggagatgggg gagaagggtgggaggtggatggtttggaaaagggatggagacccagacggagagaagccagccagccagggtgagggaac aagctgctgtgctgcccaggagaggcctggcctcaggctgccagcctcagggaggtagatgcggctgtgacagcagcaaa gaatgacggccaagggcgacagcaggggctggccatgctgtaaaggggcttcttgggagggtccagcctcaggaatcaag gggaactcctgagccgagaattctgaagatctcctccctccctgaagctgtgggctgggccatcggaaaactttcagttt tgtttccttgcctgcaagaaacgaaactaaccgaaagcctgcagagagcagaacATGgaaggagacttctcggtgtgcag gaactggtaagaaagtgctttctccagcggcagacccgggctggcgagggagagacgtagacgacatagggctgtttctg aagggagcagaaagtggttcctgcataagaacacttaggaggacaagcagctggagaccgtgggccccaagggtaggagg gtttaaacttggtaatctctgggtgggggtgggcagcattacctccacttcactgcagcccctttcccccaaatgttagg ctttctgggacagttctgaagccaaatagcccggccagtggtcccaactgggctactcatacttgtcGGGGATCCACCGG TCGCCACCATG


Regulated genes (or markers): 0
Regulatory sequences (genomic): 0
Regulatory sequences (artificial): 0
Transcription factors: 0
Transcription factor profiles: 0
Annotated publications: 0

Generate GFF

If you would like to generate a current GFF file for this project immediately, click the button below to do so. The file will be made available for download in a new window. The new window may be safely closed once you have downloaded the file. Note that GFF file generation may take a significant amount of time for larger projects.
Pre-generated GFF files are available in the downloads section. Public projects are checked weekly and updated files are generated if there are changes.

Access project data

View all data now in or (not recommended—please use a filter to reduce output size and load time)
Restrict to genomic region »
also restrict by base pair   start   end
Restrict to one or more regulated genes or markers »
Restrict to sequence length »
Only show results with a sequence length that is bases
Restrict to a specific TF classification class or family »
There are no class or family annotations to filter in this project.
Restrict to protein-DNA interaction quality »
Restrict to sequences where interaction is
Restrict to expression outcome »
Restrict to sequences where expression is
Restrict to one or more evidence types »
Restrict to one or more experimental methods »
View filtered data in or